control scrambled shrna lentivirus  (OriGene)

Journal: International Journal of Molecular Sciences

Article Title: Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes

doi: 10.3390/ijms27104231

Figure Lengend Snippet: TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

Article Snippet: Short hairpin RNA targeting human TCF7 (shRNA) and a scramble control shRNA were purchased from OriGene with Cat.No.TR30004.

Techniques: Expressing, Immunofluorescence, Staining, Control, Western Blot, Knock-Out, Isolation, shRNA, Construct, Plasmid Preparation

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: ( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence endogenous RNF10 or scramble shRNA (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.

Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

Techniques: Injection, shRNA, Two Tailed Test, Modification

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: ( A ) qRT-PCR analysis for the expression of endogenous RNF10 following injection with scramble shRNA (n=13), shRNF10 (n=13) or shRNF10 + ShResistant (n=10) in the mouse dCA1. Gene expression was normalized to TUBA1A (Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test. p≤0.0001). ( B ) Performance in the object location test 24 h following the sample phase for Scr (n = 14), ShRNF10 (n = 15) and ShRNF10 + ShResistant (n = 14) mice, expressed as the discrimination ratio (One-way ANOVA with Tukey’s post hoc test. Scr vs ShRNF10 p=0.0001; Scr vs Sh+ShResistant p=0.9078; ShRNF10 vs Sh+ShResistant p=0.0004) ( C ) Number of trials (Mixed-effects model with Fisher’s LSD multiple comparisons test. SD: Scr vs ShRNF10 p=0.5918; Scr vs Sh+ShResistant p=0.0656; ShRNF10 vs Sh+ShResistant p=0.1781; SDRe: Scr vs ShRNF10 p=0.0202; Scr vs Sh+ShResistant p=0.1125; ShRNF10 vs Sh+ShResistant p=0.7725) and ( D ) time (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance. SD: Scr vs ShRNF10 p=0.9953; Scr vs Sh+ShResistant p=0.0119; ShRNF10 vs Sh+ShResistant p=0.0130; SDRe: Scr vs ShRNF10 p=0.0456; Scr vs Sh+ShResistant p=0.2449; ShRNF10 vs Sh+ShResistant p=0.6527) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( E ) Latency to make a correct response (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance; SD: Scr vs ShRNF10 p=0.8420; Scr vs Sh+ShResistant p=0.1186; ShRNF10 vs Sh+ShResistant p=0.0855; SDRe: Scr vs ShRNF10 p=0.0543; Scr vs Sh+ShResistant p=0.7026; ShRNF10 vs Sh+ShResistant p=0.1701) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( F ) Number of perseverant and regressive errors made by Scr (n = 19), ShRNF10 (n = 18) and ShRNF10 + ShResistant (n = 13) mice during the SDRe (Kruskal–Wallis test with Dunn’s multiple comparisons test. Perseverant: Scr vs ShRNF10 p=0.0054; Scr vs Sh+ShResistant p>0.9999; ShRNF10 vs Sh+ShResistant p=0.0358; Regressive: Scr vs ShRNF10 p=0.0.6805; Scr vs Sh+ShResistant p=0.0016; ShRNF10 vs Sh+ShResistant p=0.0527). ( G ) Comparison of time required to complete the SD vs SDRe for each group of mice (Wilcoxon test with Holm–Šidák multiple comparisons correction. Scr p<0.0001; ShRNF10 p=0.0201; Sh+ShResistant p=0.1484). Values are expressed as means ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001.

Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

Techniques: Quantitative RT-PCR, Expressing, Injection, shRNA, Gene Expression, Comparison

Journal: bioRxiv

Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

doi: 10.64898/2026.03.31.715507

Figure Lengend Snippet: (A) Representative images showing dendrites of adult mice dCA1 neurons and protrusion densities (two-tailed unpaired t-test p = 0.7367, n = 37/35) after injecting either RNF10 shRNA or the scramble control (scr; scale bar = 5 μm). ( B ) Violin plots representing, for both conditions dendritic spine width (two-tailed unpaired t-test; p = 0.0002, n = 36/35), and ( C ) dendritic spine length (two-tailed unpaired t-test; p = 0.0006, n = 37,35). ( D ) Representative images showing dendrites of adult mice dCA1 neurons of adult RNF10 KO and WT mice (scale bar = 5 μm) and quantification of protrusion densities (two-tailed unpaired t-test, p = 0.1935, n = 13/16). ( E ) Bar graphs representing, for both conditions, dendritic spine width (two-tailed unpaired t-test, p = 0.0353, n = 13/16) and ( F ) dendritic spine length (two-tailed unpaired t-test, p = 0.0327, n = 13/16). ( G ) Total dendritic length (two-tailed unpaired t-test, p = 0.0033, n = 3) and ( H ) representative sketched neurons and quantification via Sholl analysis (two-tailed paired t-test, p < 0.0001) of CA1 hippocampal neurons from brain slices of adult RNF10 KO and WT mice. ( I ) Total dendritic length (two-tailed unpaired t-test, p = 0.5581, n = 3) and ( J ) representative sketched neurons and quantification via Sholl analysis (F; two-tailed paired t-test, p = 0.5810) of DG hippocampal neurons from brain slices of adult RNF10 KO and WT mice. *p < 0.01, **p < 0.005, ***p<0.001. Values are expressed as means ± s.e.m.

Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

Techniques: Two Tailed Test, shRNA, Control