Review



control scrambled shrna lentivirus  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    OriGene control scrambled shrna lentivirus
    Control Scrambled Shrna Lentivirus, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/pGFP-C-shLenti+shRNA+Vector/bio_rxiv__64898__2026__05__07__723592-192-12-17
    Average 95 stars, based on 134 article reviews
    control scrambled shrna lentivirus - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Knockdown:

    Article Title: Targeting PLOD2 suppresses invasion and metastatic potential in radiorecurrent prostate cancer
    Article Snippet: .. To knockdown PLOD2 expression in the experimental cell lines, cells were seeded in 6-well plates and transfected with scramble control (CAT#: SR30004; Origene Inc., USA) or PLOD2 siRNA (CAT#: SR321350; Origene Inc., USA) using siTran 2.0 Transfection Reagent (CAT#: TT320001; Origene Inc., USA). ..

    Expressing:

    Article Title: Targeting PLOD2 suppresses invasion and metastatic potential in radiorecurrent prostate cancer
    Article Snippet: .. To knockdown PLOD2 expression in the experimental cell lines, cells were seeded in 6-well plates and transfected with scramble control (CAT#: SR30004; Origene Inc., USA) or PLOD2 siRNA (CAT#: SR321350; Origene Inc., USA) using siTran 2.0 Transfection Reagent (CAT#: TT320001; Origene Inc., USA). ..

    Transfection:

    Article Title: Targeting PLOD2 suppresses invasion and metastatic potential in radiorecurrent prostate cancer
    Article Snippet: .. To knockdown PLOD2 expression in the experimental cell lines, cells were seeded in 6-well plates and transfected with scramble control (CAT#: SR30004; Origene Inc., USA) or PLOD2 siRNA (CAT#: SR321350; Origene Inc., USA) using siTran 2.0 Transfection Reagent (CAT#: TT320001; Origene Inc., USA). ..

    Article Title: Defects in intron recycling suppress the antiviral response via a mechanism of intronic endogenous dsRNA
    Article Snippet: .. Each plate was transfected with either 3.6 μg DBR1 sgRNA (5′-AGA CGC TGG CGC TGG CAG AG-3′) or scramble control (OriGene) as well as 3.6 μg GFP-puro donor DNA (OriGene), 15 μg GeneArt Platinum Cas9 nuclease (Thermo Fisher Scientific), and 43 μl Lipofectamine 2000 (Thermo Fisher Scientific). ..

    Article Title: SUFU promotes GLI activity in a Hedgehog-independent manner in pancreatic cancer
    Article Snippet: .. Cells were then transfected using Lipofectamine RNAiMAX reagent (13778075, Invitrogen, MA, USA) per manufacturer instructions. siRNAs for SUFU (SI00114016), and non-targeting (NT) control (1027281) were obtained from Qiagen (MD, USA), shRNA for SUFU (TL301316V) and scramble control (TR30021V) were obtained from OriGene (MD, USA). ..

    Article Title: Defects in intron recycling suppress the antiviral response via a mechanism of intronic endogenous dsRNA.
    Article Snippet: Defects in intron recycling suppress the antiviral response via a mechanism of intronic endogenous dsRNA

    Control:

    Article Title: Targeting PLOD2 suppresses invasion and metastatic potential in radiorecurrent prostate cancer
    Article Snippet: .. To knockdown PLOD2 expression in the experimental cell lines, cells were seeded in 6-well plates and transfected with scramble control (CAT#: SR30004; Origene Inc., USA) or PLOD2 siRNA (CAT#: SR321350; Origene Inc., USA) using siTran 2.0 Transfection Reagent (CAT#: TT320001; Origene Inc., USA). ..

    Article Title: Defects in intron recycling suppress the antiviral response via a mechanism of intronic endogenous dsRNA
    Article Snippet: .. Each plate was transfected with either 3.6 μg DBR1 sgRNA (5′-AGA CGC TGG CGC TGG CAG AG-3′) or scramble control (OriGene) as well as 3.6 μg GFP-puro donor DNA (OriGene), 15 μg GeneArt Platinum Cas9 nuclease (Thermo Fisher Scientific), and 43 μl Lipofectamine 2000 (Thermo Fisher Scientific). ..

    Article Title: SUFU promotes GLI activity in a Hedgehog-independent manner in pancreatic cancer
    Article Snippet: .. Cells were then transfected using Lipofectamine RNAiMAX reagent (13778075, Invitrogen, MA, USA) per manufacturer instructions. siRNAs for SUFU (SI00114016), and non-targeting (NT) control (1027281) were obtained from Qiagen (MD, USA), shRNA for SUFU (TL301316V) and scramble control (TR30021V) were obtained from OriGene (MD, USA). ..

    Article Title: Defects in intron recycling suppress the antiviral response via a mechanism of intronic endogenous dsRNA.
    Article Snippet: Defects in intron recycling suppress the antiviral response via a mechanism of intronic endogenous dsRNA

    Article Title: Nutrient sensing receptor GPRC6A regulates mTORC1 signaling and Tau biology
    Article Snippet: Cells were harvested for whole protein extraction after 72 h. The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs. .. The pGFP-A-shAAV shRNA plasmid (Origene, #TR30034) served as the scramble control to produce turbo GFP (tGFP) as the reporter protein. ..

    Article Title: CCL2-mediated endothelial injury drives cardiac dysfunction in long COVID
    Article Snippet: .. CCL2 was knocked down in iPSC-ECs using an MCP1 (CCL2) Human shRNA Lentiviral Particle Kit that included four unique 29mer target-specific shRNAs and one scramble control (OriGene, TL316716V). ..

    Article Title: The expression level of CACNA1C-encoded Ca V 1.2 is a tipping point between promotion and inhibition of dendritic growth in neurons
    Article Snippet: .. pGFP-V-RS-Ca V 1.2-shRNA and scramble control were purchased from OriGene (cat. # TG500242, Locus ID12288 and cat. # TR30013, respectively). .. The shRNA sequence toward Ca V 1.2 used in this study reads 5’-TCAGAAGTGCCTCACTGTTCTCGTGACCT- 3’ (Tube ID: TG500242B – GI356982, Origene) while the scramble sequence is 5 ’ GCACTACCAGAGCTAACTCAGATAGTACT-3’.

    Article Title: Deciphering the Role of Different Ceramide Synthases in the Human Cardiomyocyte Hypertrophic Response
    Article Snippet: The immortalized human ventricular cardiomyocytes and all consumables needed to maintain the myocytes, including PriGrow I media, penicillin/strep, and extracellular matrix, were purchased from Applied Biological Materials (Bellingham, WA, USA). .. CERS2 siRNA and the universal scramble control (#SR323951) were purchased from Origene (Rockville, MD, USA). .. Silencer siRNA for CERS5 (#AM16708, siRNA ID #131807), CERS6 (#AM16708, siRNA ID #149485), and Silencer Negative Control #5 siRNA (#AM4642) were obtained through Invitrogen (Waltham, MA, USA).

    shRNA:

    Article Title: SUFU promotes GLI activity in a Hedgehog-independent manner in pancreatic cancer
    Article Snippet: .. Cells were then transfected using Lipofectamine RNAiMAX reagent (13778075, Invitrogen, MA, USA) per manufacturer instructions. siRNAs for SUFU (SI00114016), and non-targeting (NT) control (1027281) were obtained from Qiagen (MD, USA), shRNA for SUFU (TL301316V) and scramble control (TR30021V) were obtained from OriGene (MD, USA). ..

    Article Title: Nutrient sensing receptor GPRC6A regulates mTORC1 signaling and Tau biology
    Article Snippet: Cells were harvested for whole protein extraction after 72 h. The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs. .. The pGFP-A-shAAV shRNA plasmid (Origene, #TR30034) served as the scramble control to produce turbo GFP (tGFP) as the reporter protein. ..

    Article Title: CCL2-mediated endothelial injury drives cardiac dysfunction in long COVID
    Article Snippet: .. CCL2 was knocked down in iPSC-ECs using an MCP1 (CCL2) Human shRNA Lentiviral Particle Kit that included four unique 29mer target-specific shRNAs and one scramble control (OriGene, TL316716V). ..

    Plasmid Preparation:

    Article Title: Nutrient sensing receptor GPRC6A regulates mTORC1 signaling and Tau biology
    Article Snippet: Cells were harvested for whole protein extraction after 72 h. The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs. .. The pGFP-A-shAAV shRNA plasmid (Origene, #TR30034) served as the scramble control to produce turbo GFP (tGFP) as the reporter protein. ..



    Similar Products

    control scrambled plasmid sh nc  (Genechem)
    86
    Genechem control scrambled plasmid sh nc
    Control Scrambled Plasmid Sh Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/control+nc+plasmid+scrambled+sh/pmc13203321-46-22-29
    Average 86 stars, based on 1 article reviews
    control scrambled plasmid sh nc - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    control scrambled shrna lentivirus  (OriGene)
    95
    OriGene control scrambled shrna lentivirus
    Control Scrambled Shrna Lentivirus, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/pGFP-C-shLenti+shRNA+Vector/bio_rxiv__64898__2026__05__07__723592-192-12-17
    Average 95 stars, based on 1 article reviews
    control scrambled shrna lentivirus - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    scramble control shrna  (OriGene)
    95
    OriGene scramble control shrna
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Scramble Control Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pmc13206788-418-9-15
    Average 95 stars, based on 1 article reviews
    scramble control shrna - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    scramble shrnas  (OriGene)
    95
    OriGene scramble shrnas
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Scramble Shrnas, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pm42119389-90-23-25
    Average 95 stars, based on 1 article reviews
    scramble shrnas - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    non targeting scrambled shrna  (OriGene)
    95
    OriGene non targeting scrambled shrna
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Non Targeting Scrambled Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/Lentiviral+Control+Particles/pmc13004431-53-1-9
    Average 95 stars, based on 1 article reviews
    non targeting scrambled shrna - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    nontargeting scrambled negative control short hairpin rna shnc  (Shanghai Genechem Ltd)
    86
    Shanghai Genechem Ltd nontargeting scrambled negative control short hairpin rna shnc
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Nontargeting Scrambled Negative Control Short Hairpin Rna Shnc, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/control+lentivirus+negative/pmc13265161-79-14-32
    Average 86 stars, based on 1 article reviews
    nontargeting scrambled negative control short hairpin rna shnc - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    control scrambled shrna sh nc  (Shanghai Genechem Ltd)
    86
    Shanghai Genechem Ltd control scrambled shrna sh nc
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Control Scrambled Shrna Sh Nc, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/scramble+shrna/pm42029952-113-12-19
    Average 86 stars, based on 1 article reviews
    control scrambled shrna sh nc - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    non targeting scrambled negative control  (Genechem)
    86
    Genechem non targeting scrambled negative control
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Non Targeting Scrambled Negative Control, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/control+non+targeting/pm42036013-141-20-28
    Average 86 stars, based on 1 article reviews
    non targeting scrambled negative control - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    scramble control  (OriGene)
    94
    OriGene scramble control
    <t>TCF7</t> regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, <t>shRNA,</t> shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).
    Scramble Control, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/pCas-Scramble/pmc13189227-215-18-20
    Average 94 stars, based on 1 article reviews
    scramble control - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    scramble shrna  (OriGene)
    95
    OriGene scramble shrna
    ( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence <t>endogenous</t> <t>RNF10</t> or scramble <t>shRNA</t> (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.
    Scramble Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scramble+control/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/bio_rxiv__64898__2026__03__31__715507-36-12-16
    Average 95 stars, based on 1 article reviews
    scramble shrna - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

    Journal: International Journal of Molecular Sciences

    Article Title: Unfolding Immune Dysregulation in COPD: Identification of a Three-Gene Signature and Functional Validation of TCF7 in Human Lung Tissue and T Lymphocytes

    doi: 10.3390/ijms27104231

    Figure Lengend Snippet: TCF7 regulates pro−caspase−8 expression in T lymphocytes and is significantly reduced in COPD. ( A ) Immunofluorescence co−staining of control human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Scale bar is 50 μm. ( B ) Immunofluorescence co−staining of COPD human lung tissue displaying separate channels for DAPI (blue), caspase−8 (green), TCF7 (red), and the merged image. Note the marked reduction in both TCF7 and caspase−8 signals compared to the control. Scale bar is 50 μm. ( C ) Representative Western blot images of TCF7 (50 kDa), pro−caspase−8 (55 kDa), and internal control β−tubulin (55 kDa) in wild type (WT) and TCF7 knockout (KO) Jurkat T cells. ( D ) Quantitative densitometric analysis of TCF7 protein levels comparing WT and KO groups. ( E ) Quantitative densitometric analysis of pro−caspase−8 protein levels comparing WT and KO groups. ( F ) Representative Western blot images of TCF7 and β−tubulin in primary T lymphocytes isolated from the peripheral blood of healthy donors (Control) and patients with COPD (Model). ( G ) Quantitative densitometric analysis of TCF7 protein levels in human primary T lymphocytes. ( H ) Representative Western blot images of TCF7 and β−tubulin protein levels in Jurkat T cells across four experimental conditions including Control, shRNA, shRNA plus TCF7 Rescue construct, and shRNA plus Empty Vector. ( I ) Quantitative densitometric analysis of TCF7 protein levels across the four experimental rescue groups. ( J ) Representative Western blot images of pro−caspase−8 and β−tubulin protein levels across the same four experimental conditions in Jurkat T cells. ( K ) Quantitative densitometric analysis of pro−caspase−8 protein levels across the four experimental rescue groups. Data in the bar charts are presented as mean ± SD ( n = 4 for primary human cells, n = 3 for cell line experiments). Statistical significance was assessed using Student’s t test with Welch’s correction where appropriate (* p < 0.05, *** p < 0.001, ns indicates not significant).

    Article Snippet: Short hairpin RNA targeting human TCF7 (shRNA) and a scramble control shRNA were purchased from OriGene with Cat.No.TR30004.

    Techniques: Expressing, Immunofluorescence, Staining, Control, Western Blot, Knock-Out, Isolation, shRNA, Construct, Plasmid Preparation

    ( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence endogenous RNF10 or scramble shRNA (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.

    Journal: bioRxiv

    Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

    doi: 10.64898/2026.03.31.715507

    Figure Lengend Snippet: ( A ) Male mice were bilaterally injected in the dCA1 with AAV carrying specific short hairpin RNAs (shRNF10, orange) to silence endogenous RNF10 or scramble shRNA (Scr, light blue). Representative image of a coronal section of dCA1. ( B ) mRNA levels of endogenous RNF10 following injection with shRNA RNF10 or a scramble shRNA in the dCA1 (two-tailed unpaired t - test, p < 0.001, n = 4/5). ( C ) Performance in the object location test 2 and 24 h following the sample phase for Scr (n = 5) and ShRNF10 (n = 5) mice, expressed as the discrimination ratio (two-tailed unpaired t -test, 2 h: p = 0.0081, 24 h: p = 0.0004). ( D ) Schematic of the automated visual cue response discrimination and reversal test. ( E ) Number of trials (SD: two-tailed unpaired t -test, p = 0.8650; SDRe: two-tailed unpaired t -test, p = 0.0112), ( F ) Time (SD: two-tailed unpaired t -test, p = 0.6923; SDRe: two-tailed unpaired t -test, p = 0.0007), and ( G ) Latency to make a correct response (SD: two-tailed unpaired t -test, p = 0.8090; SDRe: two-tailed unpaired t -test, p = 0.050) required by Scr (n = 11) and ShRNF10 (n = 10) mice to complete the SD and SDRe. ( H ) Number of perseverant (two-tailed unpaired t -test, t = 2.53, df = 19, p = 0.020) and regressive (two-tailed unpaired t -test, p = 0.6690) errors made by Scr (n = 11) and ShRNF10 (n = 10) mice during the SDRe. ( I ) Freezing behavior (expressed in s) of Scr (n = 8) and ShRNF10 (n = 8) mice during baseline, conditioning (three-tone–shock pairings), and post-conditioning stages of the fear conditioning learning (two-way RM ANOVA, stage x group, F( 2,28 ) = 0.73, p = 0.4893). ( J ) Freezing behavior of Scr (n = 8) and ShRNF10 (n = 8) mice during memory recall 2 weeks following the conditioning in the conditioning chamber (context A, two-tailed unpaired t -test, p = 0.0268) or in ( K ) a modified chamber (context B, two-tailed unpaired t -test, p = 0.2474) or in ( L ) a modified chamber in the presence of the conditioned tone (two-tailed unpaired t -test, p = 0.9856). ( M ) Freezing behavior of Scr (n = 6) and ShRNF10 (n = 6) mice during the memory recall 4 weeks following conditioning (two-tailed unpaired t -test, p = 0.9587). *p < 0.05, **p < 0.01, ***p < 0.005. Values are expressed as means ± s.e.m.

    Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

    Techniques: Injection, shRNA, Two Tailed Test, Modification

    ( A ) qRT-PCR analysis for the expression of endogenous RNF10 following injection with scramble shRNA (n=13), shRNF10 (n=13) or shRNF10 + ShResistant (n=10) in the mouse dCA1. Gene expression was normalized to TUBA1A (Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test. p≤0.0001). ( B ) Performance in the object location test 24 h following the sample phase for Scr (n = 14), ShRNF10 (n = 15) and ShRNF10 + ShResistant (n = 14) mice, expressed as the discrimination ratio (One-way ANOVA with Tukey’s post hoc test. Scr vs ShRNF10 p=0.0001; Scr vs Sh+ShResistant p=0.9078; ShRNF10 vs Sh+ShResistant p=0.0004) ( C ) Number of trials (Mixed-effects model with Fisher’s LSD multiple comparisons test. SD: Scr vs ShRNF10 p=0.5918; Scr vs Sh+ShResistant p=0.0656; ShRNF10 vs Sh+ShResistant p=0.1781; SDRe: Scr vs ShRNF10 p=0.0202; Scr vs Sh+ShResistant p=0.1125; ShRNF10 vs Sh+ShResistant p=0.7725) and ( D ) time (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance. SD: Scr vs ShRNF10 p=0.9953; Scr vs Sh+ShResistant p=0.0119; ShRNF10 vs Sh+ShResistant p=0.0130; SDRe: Scr vs ShRNF10 p=0.0456; Scr vs Sh+ShResistant p=0.2449; ShRNF10 vs Sh+ShResistant p=0.6527) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( E ) Latency to make a correct response (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance; SD: Scr vs ShRNF10 p=0.8420; Scr vs Sh+ShResistant p=0.1186; ShRNF10 vs Sh+ShResistant p=0.0855; SDRe: Scr vs ShRNF10 p=0.0543; Scr vs Sh+ShResistant p=0.7026; ShRNF10 vs Sh+ShResistant p=0.1701) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( F ) Number of perseverant and regressive errors made by Scr (n = 19), ShRNF10 (n = 18) and ShRNF10 + ShResistant (n = 13) mice during the SDRe (Kruskal–Wallis test with Dunn’s multiple comparisons test. Perseverant: Scr vs ShRNF10 p=0.0054; Scr vs Sh+ShResistant p>0.9999; ShRNF10 vs Sh+ShResistant p=0.0358; Regressive: Scr vs ShRNF10 p=0.0.6805; Scr vs Sh+ShResistant p=0.0016; ShRNF10 vs Sh+ShResistant p=0.0527). ( G ) Comparison of time required to complete the SD vs SDRe for each group of mice (Wilcoxon test with Holm–Šidák multiple comparisons correction. Scr p<0.0001; ShRNF10 p=0.0201; Sh+ShResistant p=0.1484). Values are expressed as means ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001.

    Journal: bioRxiv

    Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

    doi: 10.64898/2026.03.31.715507

    Figure Lengend Snippet: ( A ) qRT-PCR analysis for the expression of endogenous RNF10 following injection with scramble shRNA (n=13), shRNF10 (n=13) or shRNF10 + ShResistant (n=10) in the mouse dCA1. Gene expression was normalized to TUBA1A (Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test. p≤0.0001). ( B ) Performance in the object location test 24 h following the sample phase for Scr (n = 14), ShRNF10 (n = 15) and ShRNF10 + ShResistant (n = 14) mice, expressed as the discrimination ratio (One-way ANOVA with Tukey’s post hoc test. Scr vs ShRNF10 p=0.0001; Scr vs Sh+ShResistant p=0.9078; ShRNF10 vs Sh+ShResistant p=0.0004) ( C ) Number of trials (Mixed-effects model with Fisher’s LSD multiple comparisons test. SD: Scr vs ShRNF10 p=0.5918; Scr vs Sh+ShResistant p=0.0656; ShRNF10 vs Sh+ShResistant p=0.1781; SDRe: Scr vs ShRNF10 p=0.0202; Scr vs Sh+ShResistant p=0.1125; ShRNF10 vs Sh+ShResistant p=0.7725) and ( D ) time (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance. SD: Scr vs ShRNF10 p=0.9953; Scr vs Sh+ShResistant p=0.0119; ShRNF10 vs Sh+ShResistant p=0.0130; SDRe: Scr vs ShRNF10 p=0.0456; Scr vs Sh+ShResistant p=0.2449; ShRNF10 vs Sh+ShResistant p=0.6527) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( E ) Latency to make a correct response (Mixed-effects model with Fisher’s LSD multiple comparisons test; single pooled variance; SD: Scr vs ShRNF10 p=0.8420; Scr vs Sh+ShResistant p=0.1186; ShRNF10 vs Sh+ShResistant p=0.0855; SDRe: Scr vs ShRNF10 p=0.0543; Scr vs Sh+ShResistant p=0.7026; ShRNF10 vs Sh+ShResistant p=0.1701) required by Scr (n = 19/17), ShRNF10 (n = 18/17) and ShRNF10 + ShResistant (n = 13/8) mice to complete the SD and SDRe. ( F ) Number of perseverant and regressive errors made by Scr (n = 19), ShRNF10 (n = 18) and ShRNF10 + ShResistant (n = 13) mice during the SDRe (Kruskal–Wallis test with Dunn’s multiple comparisons test. Perseverant: Scr vs ShRNF10 p=0.0054; Scr vs Sh+ShResistant p>0.9999; ShRNF10 vs Sh+ShResistant p=0.0358; Regressive: Scr vs ShRNF10 p=0.0.6805; Scr vs Sh+ShResistant p=0.0016; ShRNF10 vs Sh+ShResistant p=0.0527). ( G ) Comparison of time required to complete the SD vs SDRe for each group of mice (Wilcoxon test with Holm–Šidák multiple comparisons correction. Scr p<0.0001; ShRNF10 p=0.0201; Sh+ShResistant p=0.1484). Values are expressed as means ± s.e.m. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001.

    Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

    Techniques: Quantitative RT-PCR, Expressing, Injection, shRNA, Gene Expression, Comparison

    (A) Representative images showing dendrites of adult mice dCA1 neurons and protrusion densities (two-tailed unpaired t-test p = 0.7367, n = 37/35) after injecting either RNF10 shRNA or the scramble control (scr; scale bar = 5 μm). ( B ) Violin plots representing, for both conditions dendritic spine width (two-tailed unpaired t-test; p = 0.0002, n = 36/35), and ( C ) dendritic spine length (two-tailed unpaired t-test; p = 0.0006, n = 37,35). ( D ) Representative images showing dendrites of adult mice dCA1 neurons of adult RNF10 KO and WT mice (scale bar = 5 μm) and quantification of protrusion densities (two-tailed unpaired t-test, p = 0.1935, n = 13/16). ( E ) Bar graphs representing, for both conditions, dendritic spine width (two-tailed unpaired t-test, p = 0.0353, n = 13/16) and ( F ) dendritic spine length (two-tailed unpaired t-test, p = 0.0327, n = 13/16). ( G ) Total dendritic length (two-tailed unpaired t-test, p = 0.0033, n = 3) and ( H ) representative sketched neurons and quantification via Sholl analysis (two-tailed paired t-test, p < 0.0001) of CA1 hippocampal neurons from brain slices of adult RNF10 KO and WT mice. ( I ) Total dendritic length (two-tailed unpaired t-test, p = 0.5581, n = 3) and ( J ) representative sketched neurons and quantification via Sholl analysis (F; two-tailed paired t-test, p = 0.5810) of DG hippocampal neurons from brain slices of adult RNF10 KO and WT mice. *p < 0.01, **p < 0.005, ***p<0.001. Values are expressed as means ± s.e.m.

    Journal: bioRxiv

    Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility

    doi: 10.64898/2026.03.31.715507

    Figure Lengend Snippet: (A) Representative images showing dendrites of adult mice dCA1 neurons and protrusion densities (two-tailed unpaired t-test p = 0.7367, n = 37/35) after injecting either RNF10 shRNA or the scramble control (scr; scale bar = 5 μm). ( B ) Violin plots representing, for both conditions dendritic spine width (two-tailed unpaired t-test; p = 0.0002, n = 36/35), and ( C ) dendritic spine length (two-tailed unpaired t-test; p = 0.0006, n = 37,35). ( D ) Representative images showing dendrites of adult mice dCA1 neurons of adult RNF10 KO and WT mice (scale bar = 5 μm) and quantification of protrusion densities (two-tailed unpaired t-test, p = 0.1935, n = 13/16). ( E ) Bar graphs representing, for both conditions, dendritic spine width (two-tailed unpaired t-test, p = 0.0353, n = 13/16) and ( F ) dendritic spine length (two-tailed unpaired t-test, p = 0.0327, n = 13/16). ( G ) Total dendritic length (two-tailed unpaired t-test, p = 0.0033, n = 3) and ( H ) representative sketched neurons and quantification via Sholl analysis (two-tailed paired t-test, p < 0.0001) of CA1 hippocampal neurons from brain slices of adult RNF10 KO and WT mice. ( I ) Total dendritic length (two-tailed unpaired t-test, p = 0.5581, n = 3) and ( J ) representative sketched neurons and quantification via Sholl analysis (F; two-tailed paired t-test, p = 0.5810) of DG hippocampal neurons from brain slices of adult RNF10 KO and WT mice. *p < 0.01, **p < 0.005, ***p<0.001. Values are expressed as means ± s.e.m.

    Article Snippet: For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and scramble shRNA (purchased from Origene, Rockville, MD) were subcloned downstream of U6 in the U6-CamKIIa.mCherry-WPRE backbone (provided by Prof. Daniela Mauceri, University of Heidelberg, DE) using BamHI and HindIII restriction enzymes (New England Biolabs, USA).

    Techniques: Two Tailed Test, shRNA, Control